Home Group Register Sign in Contact Us Sitemap
Learn more
Name Sequence(5'-3') Name Sequence(5'-3')
1492R TACGGYTACCTTGTTACGACTT MT_Forward CATCTCAGTGCAACTAAA
27F AGAGTTTGATCMTGGCTCAG pBacPAC-RP GTCTGTAAATCAACAACGC
35S-A AAGGGTCTTGCGAAGGATAG pBAD-F ATGCCATAGCATTTTTATCCA
35S-B AGTGGAAAAGGAAGGTGGCT pBAD-FP ATGCCATAGCATTTTTATCC
518F CCAGCAGCCGCGGTAATACG pBAD-R GATTTAATCTGTATCAGG
800R TACCAGGGTATCTAATCC pDONOR-FP TAACGCTAGCATGGATCTC
AD_Reverse AGATGGTGCACGATGCACAG pEGFP_N CCGTCCAGCTCGACCAG
a-Factor TACTATTGCCAGCATTGCTGC pEGFP-FP TTTAGTGAACCGTCAGATC
AOX1_Forward GACTGGTTCCAATTGACAAGC pEGFP-RP AACAGCTCCTCGCCCTTG
AOX1_Reverse GCAAATGGCATTCTGACATCC pESP-RP TCCAAAAGAAGTCGAGTGG
BGH-R TAGAAGGCACAGTCGAGG pET-24a GGGTTATGCTAGTTATTGCTCAG
Bluescript_KS TCGAGGTCGACGGTATC pET-RP CTAGTTATTGCTCAGCGG
Bluescript_SK CGCTCTAGAACTAGTGGATC pFastBac_Forward GGATTATTCATACCGTCCCA
CMV-F CGCAAATGGGCGGTAGGCGTG pFastBac_Reverse CAAATGTGGTATGGCTGATT
CYC1_Reverse GCGTGAATGTAAGCGTGAC pGEX3 GGAGCTGCATGTGTCAGAGG
DsRed1-C AGCTGGACATCACCTCCCACAACG pGEX5 GGCAAGCCACGTTTGGTG
DsRed1-N GTACTGGAACTGGGGGGACAG pJET1_2F CGACTCACTATAGGGAGAGCGGC
EBV-RP GTGGTTTGTCCAAACTCATC pJET1_2R AAGAACATCGATTTTCCATGGCAG
EGFP-C CATGGTCCTGCTGGAGTTCGTG pMalE TCAGACTGTCGATGAAGC
EGFP-CF AGCACCCAGTCCGCCCTGAGC pQE-F CCCGAAAAGTGCCACCTG
EGFP-CR CGTCCATGCCGAGAGTG pQE-R GTTCTGAGGTCATTACTGG
EGFP-N CGTCGCCGTCCAGCTCGACCAG pREP-fwd_primer GCTCGATACAATAAACGCC
EGFP-NR CGTCGCCGTCCAGCTC pRH_Forward CTGTCTCTATACTCCCCTATAG
GAL1_Forward AATATACCTCTATACTTTAACGTC pRH_Reverse CAAAATTCAATAGTTACTATCGC
Gal4AD TACCACTACAATGGATG pTrcHis_Forward GAGGTATATATTAATGTATCG
GLprimer1 TGTATCTTATGGTACTGTAACTG QE_Promoter CCGAAAAGTGCCACCTG
GLprimer2 CTTTATGTTTTTGGCGTCTTCCA RVprimer3 CTAGCAAAATAGGCTGTCCC
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA RVprimer4 GACGATAGTCATGCCCCGCG
ITS1 TCCGTAGGTGAACCTGCGG SP6 ATTTAGGTGACACTATAG
ITS2 GCTGCGTTCTTCATCGATGC STag_18mer_Primer GAACGCCAGCACATGGAC
ITS3 GCATCGATGAAGAACGCAGC SV40-pArev CCTCTACAAATGTGGTATGG
ITS4 TCCTCCGCTTATTGATATGC SV40-Promoter GCCCCTAACTCCGCCCATCC
ITS5 GGAAGTAAAAGTCGTAACAAGG T3 ATTAACCCTCACTAAAG
KAN2-FP ACCTACAACAAAGCTCTCATCAACC T7 AATACGACTCACTATAG
KAN2-RP GCAATGTAACATCAGAGATTTTGAG T7_EEV ATGTCGTAATAACCCCGCCCCG
LCO1490 GGTCAACAAATCATAAAGATATTGG T7promoter TAATACGACTCACTATAGGG
M13F GTAAAACGACGGCCAGT T7terminator GCTAGTTATTGCTCAGCGG
M13-FP TGTAAAACGACGGCCAGT U-19mer_Primer GTTTTCCCAGTCACGACGT
M13F-pUC GTTTTCCCAGTCACGAC Psomagen_Primer_Forward ATGCATGCATGCATGCATGC
M13R GCGGATAACAATTTCACACAGG Psomagen_Primer_Reverse ATGCATGCATGCATGCATGC
M13R-pUC CAGGAAACAGCTATGAC